Maximizing viral detection with SIV droplet digital PCR (ddPCR) assays.

Highly sensitive detection of HIV-1 nucleic acids is of critical importance for evaluating treatment interventions superimposed on combination antiretroviral therapy (cART) in HIV-1 infected individuals.

SIV infection of rhesus macaques models many key aspects of human HIV-1 infection and plays a key role in evaluation of approaches for prevention, treatment and attempted eradication of HIV infection.

ACTR8 Antibody

1-CSB-PA872523LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

ACTR8 Polyclonal Antibody

A57990 100 µg
EUR 570.55
Description: reagents widely cited

ACTR8 cloning plasmid

CSB-CL872523HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgatactaatgaagatgggtttttcagggattgtggtccatcaggagtctgtgtgtgccacctatggaagtggcttaagcagcacgtgtattgtagacgttggggaccagaagacaagtgtatgctgtgtggaggatggggtgtctcatcggaatactcgcatcttttcctggaa
  • Show more
Description: A cloning plasmid for the ACTR8 gene.

ACTR8 Antibody, HRP conjugated

1-CSB-PA872523LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ACTR8 Antibody, FITC conjugated

1-CSB-PA872523LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ACTR8 Antibody, Biotin conjugated

1-CSB-PA872523LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTR8. Recognizes ACTR8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ACTR8 shRNA Plasmid

20-abx964228
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ACTR8 shRNA Plasmid

20-abx974666
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ACTR8 Recombinant Protein (Human)

RP000439 100 ug Ask for price

ACTR8 Recombinant Protein (Mouse)

RP114101 100 ug Ask for price

ACTR8 Polyclonal Antibody, Biotin Conjugated

A57991 100 µg
EUR 570.55
Description: Ask the seller for details

ACTR8 Polyclonal Antibody, FITC Conjugated

A57992 100 µg
EUR 570.55
Description: The best epigenetics products

ACTR8 Polyclonal Antibody, HRP Conjugated

A57993 100 µg
EUR 570.55
Description: kits suitable for this type of research

ACTR8 ORF Vector (Human) (pORF)

ORF000147 1.0 ug DNA
EUR 95.00

Actr8 ORF Vector (Mouse) (pORF)

ORF038035 1.0 ug DNA
EUR 506.00

Actin-Related Protein 8 (ACTR8) Antibody

20-abx302684
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Actr8 sgRNA CRISPR Lentivector set (Mouse)

K3048501 3 x 1.0 ug
EUR 339.00

ACTR8 sgRNA CRISPR Lentivector set (Human)

K0039001 3 x 1.0 ug
EUR 339.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3048502 1.0 ug DNA
EUR 154.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3048503 1.0 ug DNA
EUR 154.00

Actr8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3048504 1.0 ug DNA
EUR 154.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0039002 1.0 ug DNA
EUR 154.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0039003 1.0 ug DNA
EUR 154.00

ACTR8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0039004 1.0 ug DNA
EUR 154.00

ACTR8 Protein Vector (Human) (pPB-His-MBP)

PV319638 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPB-His-GST)

PV319639 500 ng
EUR 329.00

ACTR8 Protein Vector (Mouse) (pPB-C-His)

PV152138 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPB-N-His)

PV152139 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPM-C-HA)

PV152140 500 ng
EUR 603.00

ACTR8 Protein Vector (Mouse) (pPM-C-His)

PV152141 500 ng
EUR 603.00

ACTR8 3'UTR Luciferase Stable Cell Line

TU000269 1.0 ml
EUR 1521.00

ACTR8 3'UTR GFP Stable Cell Line

TU050269 1.0 ml
EUR 1521.00

Actr8 3'UTR Luciferase Stable Cell Line

TU101335 1.0 ml Ask for price

Actr8 3'UTR GFP Stable Cell Line

TU151335 1.0 ml Ask for price

ACTR8 Protein Vector (Human) (pPB-C-His)

PV000585 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPB-N-His)

PV000586 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPM-C-HA)

PV000587 500 ng
EUR 329.00

ACTR8 Protein Vector (Human) (pPM-C-His)

PV000588 500 ng
EUR 329.00

Human Actin related protein 8(ACTR8) ELISA kit

E01A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin related protein 8(ACTR8) ELISA kit

E01A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Actin related protein 8(ACTR8) ELISA kit

E01A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit

E02A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit

E02A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Actin related protein 8(ACTR8) ELISA kit

E02A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin related protein 8(ACTR8) ELISA kit

E03A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin related protein 8(ACTR8) ELISA kit

E03A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin related protein 8(ACTR8) ELISA kit

E03A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Actin- related protein 8, Actr8 ELISA KIT

ELI-49090m 96 Tests
EUR 865.00

Rabbit Actin related protein 8(ACTR8) ELISA kit

E04A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Actin related protein 8(ACTR8) ELISA kit

E04A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Actin related protein 8(ACTR8) ELISA kit

E04A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Actin related protein 8(ACTR8) ELISA kit

E07A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Actin related protein 8(ACTR8) ELISA kit

E07A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Actin related protein 8(ACTR8) ELISA kit

E07A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Actin related protein 8(ACTR8) ELISA kit

E06A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Actin related protein 8(ACTR8) ELISA kit

E06A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Actin related protein 8(ACTR8) ELISA kit

E06A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Actin related protein 8(ACTR8) ELISA kit

E08A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Actin related protein 8(ACTR8) ELISA kit

E08A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Actin related protein 8(ACTR8) ELISA kit

E08A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Actin related protein 8(ACTR8) ELISA kit

E09A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Actin related protein 8(ACTR8) ELISA kit

E09A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Actin related protein 8(ACTR8) ELISA kit

E09A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Actin- related protein 8, ACTR8 ELISA KIT

ELI-11756b 96 Tests
EUR 928.00

Human Actin- related protein 8, ACTR8 ELISA KIT

ELI-11855h 96 Tests
EUR 824.00

ACTR8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791029 1.0 ug DNA
EUR 316.00

ACTR8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791030 1.0 ug DNA
EUR 316.00

ARP8 Actin Related Protein 8 Homolog (ACTR8) Antibody (HRP)

20-abx311203
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ARP8 Actin Related Protein 8 Homolog (ACTR8) Antibody (FITC)

20-abx311204
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ARP8 Actin Related Protein 8 Homolog (ACTR8) Antibody (Biotin)

20-abx311205
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea pig Actin related protein 8(ACTR8) ELISA kit

E05A0995-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Actin related protein 8(ACTR8) ELISA kit

E05A0995-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Actin related protein 8(ACTR8) ELISA kit

E05A0995-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Actin related protein 8(ACTR8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ACTR8 Protein Vector (Human) (pPM-N-D-C-HA)

PV319640 500 ng
EUR 552.00

ACTR8 Protein Vector (Human) (pPM-N-D-C-His)

PV319641 500 ng
EUR 552.00

Recombinant Human Actin-Related Protein 8/ACTR8 (N-6His)

CF89-10ug 10ug
EUR 202.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM DTT,pH7.4.

Recombinant Human Actin-Related Protein 8/ACTR8 (N-6His)

CF89-1mg 1mg
EUR 2486.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM DTT,pH7.4.

Recombinant Human Actin-Related Protein 8/ACTR8 (N-6His)

CF89-500ug 500ug
EUR 1755.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM DTT,pH7.4.

Recombinant Human Actin-Related Protein 8/ACTR8 (N-6His)

CF89-50ug 50ug
EUR 496.00
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,1mM DTT,pH7.4.

Actr8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3048505 3 x 1.0 ug
EUR 376.00

ACTR8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0039005 3 x 1.0 ug
EUR 376.00

Actr8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3048506 1.0 ug DNA
EUR 167.00

Actr8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3048507 1.0 ug DNA
EUR 167.00

Actr8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3048508 1.0 ug DNA
EUR 167.00

ACTR8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0039006 1.0 ug DNA
EUR 167.00

ACTR8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0039007 1.0 ug DNA
EUR 167.00

ACTR8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0039008 1.0 ug DNA
EUR 167.00

ACTR8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV791028 1.0 ug DNA
EUR 374.00

Here we describe two droplet digital PCR (ddPCR) assays, a ddPCR DNA assay and an RT-ddPCR RNA assay for detecting simian immunodeficiency virus (SIV) on the RainDance platform.