HIV-1 drug resistance mutations detection and HIV-1 subtype G report by using next-generation sequencing platform.

Based on world health organization (WHO) recommend, drug resistance assay should be performed in initial of treatment and after treatment for administering and monitoring of anti-retroviral regime in HIV-1 infected patients.

ADA Assay Kit

abx098403-Hitachi7170R160ml4R260ml2 Hitachi 7170; R1: 60ml×4 R2: 60ml×2
EUR 911.00
  • Shipped within 5-12 working days.

ADA Assay Kit

abx098403-Toshiba40R150ml4R250ml2 Toshiba 40; R1: 50ml×4 R2: 50ml×2
EUR 786.00
  • Shipped within 5-12 working days.

ADA Assay Kit

abx090675-100tests 100 tests
EUR 237.00
  • Shipped within 5-10 working days.

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-192 1 kit of 192 tests
EUR 1103.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-48 1 kit of 48 tests
EUR 465.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DL-ADA-Hu-96 1 kit of 96 tests
EUR 621.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Adenosine Deaminase (ADA)

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-48T 48T
EUR 498.00
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

DLR-ADA-Hu-96T 96T
EUR 647.00
  • Should the Human Adenosine Deaminase (ADA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adenosine Deaminase (ADA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-48Tests 48 Tests
EUR 500.00

Human Adenosine Deaminase (ADA) ELISA Kit

RD-ADA-Hu-96Tests 96 Tests
EUR 692.00

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-48Tests 48 Tests
EUR 522.00

Human Adenosine Deaminase (ADA) ELISA Kit

RDR-ADA-Hu-96Tests 96 Tests
EUR 724.00

ADA

GM7835-100G 100 g
EUR 86.00

ADA

GM7835-250G 250 g
EUR 150.00

ADA

GM7835-25G 25 g
EUR 54.00

ADA

GM7835-500G 500 g
EUR 229.00

ADA Enzyme

20-abx072002
  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ADA Enzyme

20-abx072003
  • EUR 913.00
  • EUR 4170.00
  • EUR 328.00
  • 150 µg
  • 1 mg
  • 20 ug
  • Shipped within 5-10 working days.

ADA siRNA

20-abx906796
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA siRNA

20-abx906797
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA siRNA

20-abx900178
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ADA antibody

70R-5745 50 ug
EUR 467.00
Description: Rabbit polyclonal ADA antibody raised against the middle region of ADA

ADA antibody

70R-5862 50 ug
EUR 467.00
Description: Rabbit polyclonal ADA antibody raised against the N terminal of ADA

ADA Antibody

ABD6184 100 ug
EUR 438.00

ADA Antibody

1-CSB-PA776767
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ADA Antibody

1-CSB-PA001268EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ADA buffer

AD0003 25g
EUR 64.79
  • Product category: Biochemicals/Biological Buffers/Common Buffers

ADA Antibody

32121-100ul 100ul
EUR 252.00

ADA Antibody

1-CSB-PA240615
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADA. Recognizes ADA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

anti-ADA

YF-PA10066 50 ug
EUR 363.00
Description: Mouse polyclonal to ADA

anti-ADA

YF-PA10067 100 ul
EUR 403.00
Description: Rabbit polyclonal to ADA

anti-ADA

YF-PA10068 100 ug
EUR 403.00
Description: Rabbit polyclonal to ADA

anti-ADA

YF-PA23174 50 ul
EUR 334.00
Description: Mouse polyclonal to ADA

ADA Antibody

DF6184 200ul
EUR 304.00
Description: ADA Antibody detects endogenous levels of total ADA.

ADA Enzyme (Recombinant)

20-abx073712
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

ADA Polyclonal Antibody

A50009 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-ADA Antibody

A00866-1 100ug/vial
EUR 334.00

Anti-ADA Antibody

A00866-2 100ug/vial
EUR 334.00

ADA Polyclonal Antibody

ABP57703-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

ABP57703-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

ABP57703-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of ADA from Human. This ADA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ADA protein at amino acid sequence of 80-160

ADA Polyclonal Antibody

E-AB-10729-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Polyclonal Antibody

E-AB-10729-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Polyclonal Antibody

E-AB-10729-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have
  • Show more
Description: Rabbit antibody against Human,Mouse,Rat ADA for WB,IHC,ELISA applications.

ADA Polyclonal Antibody

ES9364-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against ADA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ADA Polyclonal Antibody

ES9364-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against ADA from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ADA Conjugated Antibody

C32121 100ul
EUR 397.00

ADA Blocking Peptide

33R-1257 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSK3B antibody, catalog no. 70R-2198

ADA Blocking Peptide

33R-1412 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ADA antibody, catalog no. 70R-5745

Human Recombinant ADA

6393-50
EUR 436.00

ADA cloning plasmid

CSB-CL001268HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1092
  • Sequence: atggcccagacgcccgccttcgacaagcccaaagtagaactgcatgtccacctagacggatccatcaagcctgaaaccatcttatactatggcaggaggagagggatcgccctcccagctaacacagcagaggggctgctgaacgtcattggcatggacaagccgctcacccttc
  • Show more
Description: A cloning plasmid for the ADA gene.

Anti-ADA antibody

PAab00135 100 ug
EUR 355.00

Anti-ADA Antibody

PB9914 100ug/vial
EUR 334.00

ADA Blocking Peptide

DF6184-BP 1mg
EUR 195.00

ADA Rabbit pAb

A13910-100ul 100 ul
EUR 308.00

ADA Rabbit pAb

A13910-200ul 200 ul
EUR 459.00

ADA Rabbit pAb

A13910-20ul 20 ul
EUR 183.00

ADA Rabbit pAb

A13910-50ul 50 ul
EUR 223.00

ADA Rabbit pAb

A1019-100ul 100 ul
EUR 308.00

ADA Rabbit pAb

A1019-200ul 200 ul
EUR 459.00

ADA Rabbit pAb

A1019-20ul 20 ul
EUR 183.00

ADA Rabbit pAb

A1019-50ul 50 ul
EUR 223.00

ADA disodium salt

GB0256-100G 100 g
EUR 110.00

ADA disodium salt

GB0256-500G 500 g
EUR 341.00

anti- ADA antibody

FNab00135 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: adenosine deaminase
  • Uniprot ID: P00813
  • Gene ID: 100
  • Research Area: Metabolism
Description: Antibody raised against ADA

Anti-ADA antibody

STJ11100002 100 µl
EUR 413.00
Description: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia.

Anti-ADA antibody

STJ115847 100 µl
EUR 277.00
Description: This gene encodes an enzyme that catalyzes the hydrolysis of adenosine to inosine. Various mutations have been described for this gene and have been linked to human diseases. Deficiency in this enzyme causes a form of severe combined immunodeficiency disease (SCID), in which there is dysfunction of both B and T lymphocytes with impaired cellular immunity and decreased production of immunoglobulins, whereas elevated levels of this enzyme have been associated with congenital hemolytic anemia.

Anti-ADA antibody

STJ118002 100 µl
EUR 277.00

Anti-ADA antibody

STJ190522 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to ADA

Adenosine Deaminase (ADA) Antibody

20-abx171081
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenosine Deaminase (ADA) Antibody

20-abx225009
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

20-abx213960
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

20-abx214005
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

abx230135-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Adenosine Deaminase (ADA) Antibody

abx025495-100ul 100 ul
EUR 523.00
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

abx025496-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

abx025496-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

abx026363-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

abx026363-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody

20-abx302692
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human ADA shRNA Plasmid

20-abx950064
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADA protein (His tag)

80R-1874 50 ug
EUR 397.00
Description: Purified recombinant ADA protein

ADA buffer, disodium salt

AB0005 25g
EUR 66.53
  • Product category: Biochemicals/Biological Buffers/Common Buffers

ADA ELISA KIT|Human

EF005654 96 Tests
EUR 689.00

Human ADA ELISA Kit

ELA-E1390h 96 Tests
EUR 824.00

ADA Antibody, HRP conjugated

1-CSB-PA001268EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADA Antibody, FITC conjugated

1-CSB-PA001268EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADA Antibody, Biotin conjugated

1-CSB-PA001268ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADA. Recognizes ADA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse ADA shRNA Plasmid

20-abx969027
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ADA shRNA Plasmid

20-abx984357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ADA Polyclonal Conjugated Antibody

C30265 100ul
EUR 397.00

Adenosine Deaminase (ADA) Antibody

20-abx101694
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

h ADA Expression Lentivirus

LVP923 1x107 IFU/ml x 200ul
EUR 451.00
Description: Pre-made over-expression lentivirus for human target: ADA, containing a RFP-Blasticidin dual selection marker.

ADA Recombinant Protein (Human)

RP000478 100 ug Ask for price

Bovine ADA ELISA Kit

EBA0639 96Tests
EUR 521.00

Anserini ADA ELISA Kit

EAA0639 96Tests
EUR 521.00

Anti-ADA (4G4-1C6)

YF-MA10013 100 ug
EUR 363.00
Description: Mouse monoclonal to ADA

Recombinant Adenosine Deaminase (ADA)

4-RPB390Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P00813
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 57.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adenosine Deaminase expressed in: E.coli

ADA Recombinant Protein (Mouse)

RP114149 100 ug Ask for price

ADA Recombinant Protein (Rat)

RP189116 100 ug Ask for price

Chicken ADA ELISA Kit

ECKA0639 96Tests
EUR 521.00

Canine ADA ELISA Kit

ECA0639 96Tests
EUR 521.00

Rat ADA ELISA Kit

ERA0639 96Tests
EUR 521.00

Sheep ADA ELISA Kit

ESA0639 96Tests
EUR 521.00

Rabbit ADA ELISA Kit

ERTA0639 96Tests
EUR 521.00

Human ADA ELISA Kit

EHA0639 96Tests
EUR 521.00

Porcine ADA ELISA Kit

EPA0639 96Tests
EUR 521.00

Monkey ADA ELISA Kit

EMKA0639 96Tests
EUR 521.00

Mouse ADA ELISA Kit

EMA0639 96Tests
EUR 521.00

Goat ADA ELISA Kit

EGTA0639 96Tests
EUR 521.00

Human Adenosine Deaminase (ADA) Protein

20-abx065150
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Adenosine Deaminase (ADA) Antibody (HRP)

20-abx302995
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody (FITC)

20-abx302996
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Adenosine Deaminase (ADA) Antibody (Biotin)

20-abx302997
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ADA Polyclonal Antibody, HRP Conjugated

A50010 100 µg
EUR 570.55
Description: kits suitable for this type of research

ADA Polyclonal Antibody, FITC Conjugated

A50011 100 µg
EUR 570.55
Description: fast delivery possible

ADA Polyclonal Antibody, Biotin Conjugated

A50012 100 µg
EUR 570.55
Description: reagents widely cited

Adenosine deaminase (ADA) polyclonal antibody

ABP-PAB-10464 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

ELISA kit for Human ADA

EK5677 96 tests
EUR 553.00
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ADA in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ADA PicoKine ELISA Kit

EK1446 96 wells
EUR 425.00
Description: For quantitative detection of human ADA in cell culture supernates, serum and pleural fluid.

[KO Validated] ADA Polyclonal Antibody

30265-100ul 100ul
EUR 252.00

[KO Validated] ADA Polyclonal Antibody

30265-50ul 50ul
EUR 187.00

Anti-ADA Antibody (monoclonal, 6D4)

M00866 100ug/vial
EUR 334.00

Ada ORF Vector (Rat) (pORF)

ORF063040 1.0 ug DNA
EUR 506.00

ADA ORF Vector (Human) (pORF)

ORF000160 1.0 ug DNA
EUR 95.00

Ada ORF Vector (Mouse) (pORF)

ORF038051 1.0 ug DNA
EUR 506.00

[KO Validated] ADA Rabbit pAb

A18029-100ul 100 ul
EUR 410.00

[KO Validated] ADA Rabbit pAb

A18029-200ul 200 ul
EUR 571.00

[KO Validated] ADA Rabbit pAb

A18029-20ul 20 ul
EUR 221.00

[KO Validated] ADA Rabbit pAb

A18029-50ul 50 ul
EUR 287.00

Guinea Pig ADA ELISA Kit

EGA0639 96Tests
EUR 521.00

Monoclonal ADA Antibody (C-term)

APG01543G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human ADA (C-term). The antibodies are raised in Mouse. This antibody is applicable in WB

Polyclonal ADA Antibody (C-term)

APG01545G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADA (C-term). This antibody is tested and proven to work in the following applications:

Human Adenosine Deaminase (ADA) CLIA Kit

abx195053-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human ADA(Adenosine Deaminase) ELISA Kit

E-EL-H0262-192 192 tests
EUR 895.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADA. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADA and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADA, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADA. You can calculate the concentration of Human ADA in the samples by comparing the OD of the samples to the standard curve.

Human ADA(Adenosine Deaminase) ELISA Kit

E-EL-H0262-96 96 tests
EUR 530.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This ELISA kit uses the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ADA. Standards or samples are added to the micro ELISA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADA and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADA, biotinylated detection antibody and Avidin-HRP conjugate will appear blue in color. The enzyme-substrate reaction is terminated by the addition of stop solution and the color turns yellow. The optical density (OD) is measured spectrophotometrically at a wavelength of 450 nm ± 2 nm. The OD value is proportional to the concentration of Human ADA. You can calculate the concentration of Human ADA in the samples by comparing the OD of the samples to the standard curve.

Human ADA (Adenosine Deaminase) CLIA Kit

E-CL-H0218-192 192 tests
EUR 995.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This CLIA kit uses the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ADA . Standards or samples are added to the micro CLIA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADA and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADA , biotinylated detection antibody and Avidin-HRP conjugate will appear fluorescence. The Relative light unit (RLU) value is measured by the Chemiluminescence immunoassay analyzer. The RLU value is positively associated with the concentration of Human ADA . You can calculate the concentration of Human ADA in the samples by comparing the RLU value of the samples to the standard curve.

Human ADA (Adenosine Deaminase) CLIA Kit

E-CL-H0218-96 96 tests
EUR 582.00
  • No significant cross-reactivity with analogues from other species was determined. Please, note that the data on cross-reactivity is limited. Other samples, aside from the tested ones, may be suitable to be used with this kit.
Description: This CLIA kit uses the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ADA . Standards or samples are added to the micro CLIA plate wells and combined with the specific antibody. Then a biotinylated detection antibody specific for Human ADA and Avidin-Horseradish Peroxidase (HRP) conjugate are added successively to each micro plate well and incubated. Free components are washed away. The substrate solution is added to each well. Only those wells that contain Human ADA , biotinylated detection antibody and Avidin-HRP conjugate will appear fluorescence. The Relative light unit (RLU) value is measured by the Chemiluminescence immunoassay analyzer. The RLU value is positively associated with the concentration of Human ADA . You can calculate the concentration of Human ADA in the samples by comparing the RLU value of the samples to the standard curve.

Mouse Adenosine deaminase, Ada ELISA KIT

ELI-04528m 96 Tests
EUR 865.00

Rat Adenosine deaminase, Ada ELISA KIT

ELI-04529r 96 Tests
EUR 886.00

Chicken Adenosine deaminase, ADA ELISA KIT

ELI-04530c 96 Tests
EUR 928.00

Bovine Adenosine deaminase, ADA ELISA KIT

ELI-04531b 96 Tests
EUR 928.00

Human Adenosine deaminase, ADA ELISA KIT

ELI-04532h 96 Tests
EUR 824.00

Human adenosine deaminase, ADA ELISA Kit

CSB-E09613h-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human adenosine deaminase, ADA ELISA Kit

1-CSB-E09613h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human adenosine deaminase, ADA in samples from serum, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human adenosine deaminase,ADA ELISA Kit

201-12-0778 96 tests
EUR 440.00
  • This adenosine deaminase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Adenosine Deaminase (ADA) ELISA Kit

abx250831-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Sheep Adenosine Deaminase (ADA) ELISA Kit

abx364111-96tests 96 tests
EUR 926.00
  • Shipped within 5-12 working days.

Monkey Adenosine Deaminase (ADA) ELISA Kit

abx359305-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Chicken Adenosine Deaminase (ADA) ELISA Kit

abx355908-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rabbit Adenosine Deaminase (ADA) ELISA Kit

abx362164-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human Adenosine Deaminase (ADA) CLIA Kit

20-abx492721
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

NGS analyses were performed on forty-one plasma samples from HIV-1 affected patients using the Sentosa SQ HIV genotyping assay (Vela-Diagnostics, Germany).

This system comprises a semi-automated Ion torrent based platform and the sequencing results were analyzed based on ANRS, REGA and Stanford drug resistance algorithms.